Agaricus blazei AM-P13


Agaricus blazei AM-P13

Click Image to Enlarge

 

Strain: Agaricus blazei AM-P13

 

Common Names: Royal Sun, Almond Portobello, Ji Song Rong (姬松茸), Himematsutake, Brasilianischer Mandel-Champignon

 

Application: choice edible, medicinal usage and compounds

 

Characteristics: Robust caps, pale-brown to brown covered with fine scales. Gills are white then chocolate-brown. The stalk is cylindrical, white and hollow. Flesh turns yellow when cut or crushed.

 

Temperature Range: 10 to 24 °C (50 to 80 °F)

 

Recommended Substrate: Properly Prepared Mushroom Compost

Composted Substrates: There are two types of compost, those derived from straw bedding with horse manure and synthetic composts, which are simply composts lacking horse manure as a main ingredient, and are typically derived from wheat, oat, rice, and sorghum straws.

Secondary and tertiary decomposers fulfill the ecological niche of breaking down primarily cellulose and lignin. Many of the herbaceous substrates in use must be decomposed prior to the proliferation of these species. Micro-organisms are encouraged to grow on these substrates to break down readily available hemicelluloses, amino acids and soluble sugars. Nature goes to work to break down these compounds with the addition of heat, water, and oxygen. The appropriate C:N ratio must be achieved for the target species to be cultivated. Cultivation procedures are as follows; mixing and chopping the substrate materials, phase I composting, phase II composting, spawning, casing, pinning, and harvesting. This is a very critical process that must be performed exactly to the target species grown, and experienced composters should be consulted to maximize cultivation success.

 

 

Recommended species: Agaricus bisporus, Agaricus blazei, Calvatea gigantea, Coprinus comatus, Lepista nuda, Stropharia rugoso-annulata.

 

Recommended Media Type: PDY MYA MEP

 

History: Isolated By Aloha Medicinals field team

 

DNA Sequence: Agaricus blazei ABS1 – ITS – Accugenix Feb 2008:

TCCGTAGGTGAACTTGCGGAAGGATCATTATTGAATTATGTTTCTAGATAGGTTGTAGCTGGCTCTTTAGAGCATGTGCACGCCTGTTTGGACTTCATTTTCATCCACCTGTGCACCTATTGTAGTCTTTGGTTGGGTTAGGAGGAAGTGGTCATTGTGTCAGCATCTGCTGGATGTGAGGATTTGCATTGTGAAAGCTTTGCTGTCCTTGATGTGATCATGGAATCTCTTTCTCACTAGAGTCTATGTCACTCATTATACTCTGTCGAATGTCATTGAATGTCTTTACATGGGCTTGTATGCCTATGAAAATTGTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATTAAATTCTCAACTCTCTTATACTTTTTTGTAAAAGAGAGCTTGGACTGTGGAGGCTTGCTGGCCACTTTTTGGGGTCAGCTCCTCTGAAATGCATTAGCGGAACCGTTTGCGATCTGCCACAAGTGTGATAAGTTATCTACGCTGGCGAGGGGATTGCTCTCTGTAATGTTCAGCTTCTAATTGTCTCTACTTTGTGAGACTACTTTTGAATGCTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

 

Agaricus blazei ABS1 – D2

AGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGGATCAGCCTTGCTTTTGCATGGTGTACTTTCTGGTTGATGGGTCAGCATCAATTTTGACCGCTGGAAAAAGACCTGGGGAATGTGGCAGCTTCGGCTGTGTTATAGCCCCTAGTCGCATACAGTGGTTGGGATTGAGGAACTCAGCACGCCGCAAGGCCGGGTTTCGACCACGTTCGTGCTTAGGATGCTGGCATAATGGCTTTAAGCGACCCGTCTTGAAACACGGACCAAG

 

Price: $225

Add to cart

 

Overnight shipping is recommended for this culture

Our technical staff is available to answer your questions on culture media, culture maintenance, fruiting strategies or other questions that may arise as you work with cultures. For more details please see Consulting Services.

 

For all of you formulators - Aloha Medicinals also offers bulk powder ingredients for use in your formulations, which are 100% USDA and EU Certified Organic. Call our customer service representative at (775) 886-6300 for more information and to place your order today!