Inonotus obliquus AM-M207


Agrocybe aegerita AM-G11

Click Image to Enlarge

Strain: Inonotus obliquus AM-M207

 

Common Names: Chaga, Huà Shù Gū (白樺茸), Naname inonotus (斜めinonotus), Polypore cendré, Polypore oblique, Carie blanche spongieuse de bouleau, Schiefer schillerporling, Berezoviy grib (чага, березовый гриб)

 

Inonotus obliquus, commonly known as chaga, is a very rare medicinal mushroom with a long history of use. Chaga is a facultative parasitic fungus particularly on birch (Betula spp.) and occasionally on other hardwood species trees. The photos here show chaga growing on Birch and on Cassurina (locally known as Ironwood) in Hawaii. The part this has been traditionally used in medicine is the burnt-charcoal looking sterile conk, which is the trees reaction to the parasitic fungus, rather than a strictly fungal growth. The sterile conk is irregularly formed and can be anywhere up to 18 inches in diameter and weighs several pounds. It is deceivingly not the fruiting body of the fungus, but instead a mass of mycelium interspersed into the tree tissue, mostly colored black due to the presence of large amounts of melanin. The fertile fruiting body can be found very rarely as a resupinate (crustose) fungus on or near the sterile conk, usually appearing only after the host tree is dead. 

Cultivation of I. obliquus is becoming a popular concept for the sustainable production of this rare fungus. It grows slowly on various agar based media. It can then be transferred to sterilized grain for production of spawn. After the spawn run, spawn can be used for the inoculation of a bulk substrate, either grain or hardwood sawdust. The formation of sterile conks has not yet been achieved from cultivation, and only mycelium is currently being utilized for various applications, particularly in the nutriceutical industry. In traditional Eastern European and Russian medicinal use, the sterile conk is boiled for several hours to make a tea. This has a long history of medicinal use in that part of the world, and modern science has confirmed many of the traditional uses for this fungus.

 

Application:

 

Characteristics:

 

Temperature Range:

 

Recommended Substrate:

Cellulose Decomposers: Hardwood Sawdust

Most popular species under cultivation are naturally wood inhabiting fungi. So, growing on sawdust is a logical choice. Sawdust is mixed with wheat bran (or another nitrogen source) at 5-15% and Calcium Carbonate (CaCO3) (a buffering agent) at 2-3%, and filled into autoclavable bags. The bags are sterilized for a minimum of 1 hour at 121°C (15 psi when at sea level). Note sterilization exposure times vary depending on pressure and elevation. Finally, the substrate is cooled to at least 25°C (approx. 80°F) then, inoculated with grain or liquid spawn and incubated at appropriate temp for the species until colonization is complete.

Recommended species on hardwood sawdust:

Agrocybe aergerita, Antrodia camphorata, Armillaria mellea, Auricularia auricular-judae, Fistulina hepatica, Flammulina velutipes, Fomes fomentarius, Ganoderma applanatum, G. australe, G. lucidum, G. curtisii, Grifola frondosa, Hericium americanum, H. clathroides, H. coralloides, H. erinaceus, Hypholoma capnoides, H. sublateritium, Hypsizygous marmoreus, H. tessulatus, H. ulmarius, Inonotus obliquus, Laetiporus sulphureus, Lentinula edodes, Macrolepiota procera, Omphalotus sp., Panellus stipticus, Phellinus linteus, Pholiota nameko, Piptoporus betulinus, Pleurotus sp., Polyporus squamosus, Polyporus umbellatus, Schizophylum commune, Sparassis crispa, Stropharia rugoso-annulata, Trametes sp., Tremella mesenterica, and Xylaria hypoxylon

 

Recommended Media Type: PDY MYA RFA BA

 

History: Isolated By Aloha Medicinals field team

 

DNA Sequence: Inonotus obliquus AM-M207 - ITS

GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTAATCTCAAATCGCTCGTCTATTCTTAATTGAAGTGGCTTTCGATTTGGACTTGGAGGTTTTGCTGGCCCGGGCGACTTTGGTTGCCCTTGGTTTGTCGGCTCCTCTCAAATACATTAGCTGGACTTTGGTTCGCGTTTACGGTGTAATAATGTAAAGTTCACTAAGACGCTTGCCTAACAAGTCTGCTTCTAATCGTCCTTAAGTTGGACAAGGATCCCTTCGTTGGGCCTTCTTGACACCTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

 

Price: $350

Add to cart

 

Overnight shipping is recommended for this culture

Our technical staff is available to answer your questions on culture media, culture maintenance, fruiting strategies or other questions that may arise as you work with cultures. For more details please see Consulting Services.

 

For all of you formulators - Aloha Medicinals also offers bulk powder ingredients for use in your formulations, which are 100% USDA and EU Certified Organic. Call our customer service representative at (775) 886-6300 for more information and to place your order today!