Phellinus linteus AM-M220


Agrocybe aegerita AM-G11

Click Image to Enlarge

Strain: Phellinus linteus AM-M220

 

Common Names: Black Hoof Fungus, Fire Sponge, Mesima, Sāng Huáng (桑黃), Meshimakobu (メシマコブ), Feuerschwamm, Sanghwang, Trutovik (трутовик)

 

Meshima in Japanese, Song Gen in Chinese, and Sang-hwang in Korean, Phellinus linteus has been used medicinally in traditional eastern cultures for thousands of years. This species is native to Southeast Asia, also is also found in tropical and subtropical regions worldwide. This is a slow growing facultative parasite, typically growing on the branches and stems of old mulberry trees, as well as oak and poplar, causing a white pocket rot. The fruiting body is a hoof shaped conk and as its Latin name suggests (Phellinus), this mushroom has a “cork-like” texture. The pileus is chocolate brown to black with a rough surface. The margin is yellowish-tan to dark brown. The pore surface is cream to yellowish-golden. Mycelium of this species is aerial and is hyaline to yellowish-golden colored, but varies depending on the media and environmental conditions in which it is grown.

 

Application:

 

Characteristics:

 

Temperature Range:

 

Recommended Substrate:

Cellulose Decomposers: Hardwood Sawdust

Most popular species under cultivation are naturally wood inhabiting fungi. So, growing on sawdust is a logical choice. Sawdust is mixed with wheat bran (or another nitrogen source) at 5-15% and Calcium Carbonate (CaCO3) (a buffering agent) at 2-3%, and filled into autoclavable bags. The bags are sterilized for a minimum of 1 hour at 121°C (15 psi when at sea level). Note sterilization exposure times vary depending on pressure and elevation. Finally, the substrate is cooled to at least 25°C (approx. 80°F) then, inoculated with grain or liquid spawn and incubated at appropriate temp for the species until colonization is complete.

Recommended species on hardwood sawdust:

Agrocybe aergerita, Antrodia camphorata, Armillaria mellea, Auricularia auricular-judae, Fistulina hepatica, Flammulina velutipes, Fomes fomentarius, Ganoderma applanatum, G. australe, G. lucidum, G. curtisii, Grifola frondosa, Hericium americanum, H. clathroides, H. coralloides, H. erinaceus, Hypholoma capnoides, H. sublateritium, Hypsizygous marmoreus, H. tessulatus, H. ulmarius, Inonotus obliquus, Laetiporus sulphureus, Lentinula edodes, Macrolepiota procera, Omphalotus sp., Panellus stipticus, Phellinus linteus, Pholiota nameko, Piptoporus betulinus, Pleurotus sp., Polyporus squamosus, Polyporus umbellatus, Schizophylum commune, Sparassis crispa, Stropharia rugoso-annulata, Trametes sp., Tremella mesenterica, and Xylaria hypoxylon.

 

Recommended Media Type: PDY MEP V8+Y

 

History: Isolated By Aloha Medicinals field team.

 

DNA Sequence: Phellinus linteus AM-M220 - ITS.

GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTTGAGTGTCATGTTTATCTCAAACCGCTCGTCTTTCTTAATTGAAGGGCTTGAGGTTTGGACTTGGAGGTTTACTGCTGGCGCCTTTCGAGGGGTCGGCTCCTCTTAAATACATTAGCTGGGCTTTGGCTCGCGTTTACGGTGTAATAGTTGATTCCATTCACCAACGAGCGCTTGCCTGACGAGCTTGCTTCTAGCCGTCCGCGTCGTCGGACAAGGAGTCACCTCCTTCTTGACACCTTTGACCTCAAATCAGGTAGGATTACCCGCCGAACTTAAGCATATCAATAAGCGGAGGA

 

Price: $350

Add to cart

 

Overnight shipping is recommended for this culture

Our technical staff is available to answer your questions on culture media, culture maintenance, fruiting strategies or other questions that may arise as you work with cultures. For more details please see Consulting Services.

 

For all of you formulators - Aloha Medicinals also offers bulk powder ingredients for use in your formulations, which are 100% USDA and EU Certified Organic. Call our customer service representative at (775) 886-6300 for more information and to place your order today!