Tremella mesenterica AM-M296


Agrocybe aegerita AM-G11

Click Image to Enlarge

Strain: Tremella mesenterica AM-M296

 

Common Names: Witch's Butter, Yín'ěr Chángxìmó (银耳肠系膜), Tremella No Chō-kan Maku (Tremellaの腸間膜), Tremelle mésentérique, Goldgelber Zitterling, Gelatina di fungo, Drozgalka orangevaya/plenochnaya (дрожалка оранжевая/пленчатая)

 

Application:

 

Characteristics:

 

Temperature Range: High (warm strain).

 

Recommended Substrate:

Cellulose Decomposers: Hardwood Sawdust - After inoculation with Hypoxylon archerii.

Most popular species under cultivation are naturally wood inhabiting fungi. So, growing on sawdust is a logical choice. Sawdust is mixed with wheat bran (or another nitrogen source) at 5-15% and Calcium Carbonate (CaCO3) (a buffering agent) at 2-3%, and filled into autoclavable bags. The bags are sterilized for a minimum of 1 hour at 121°C (15 psi when at sea level). Note sterilization exposure times vary depending on pressure and elevation. Finally, the substrate is cooled to at least 25°C (approx. 80°F) then, inoculated with grain or liquid spawn and incubated at appropriate temp for the species until colonization is complete.

Recommended species on hardwood sawdust:

Agrocybe aergerita, Antrodia camphorata, Armillaria mellea, Auricularia auricular-judae, Fistulina hepatica, Flammulina velutipes, Fomes fomentarius, Ganoderma applanatum, G. australe, G. lucidum, G. curtisii, Grifola frondosa, Hericium americanum, H. clathroides, H. coralloides, H. erinaceus, Hypholoma capnoides, H. sublateritium, Hypsizygous marmoreus, H. tessulatus, H. ulmarius, Inonotus obliquus, Laetiporus sulphureus, Lentinula edodes, Macrolepiota procera, Omphalotus sp., Panellus stipticus, Phellinus linteus, Pholiota nameko, Piptoporus betulinus, Pleurotus sp., Polyporus squamosus, Polyporus umbellatus, Schizophylum commune, Sparassis crispa, Stropharia rugoso-annulata, Trametes sp., Tremella mesenterica, and Xylaria hypoxylon.

 

Recommended Media Type: PDY

 

History: Isolated By Aloha Medicinals field team.

 

DNA Sequence: Tremella mesenterica AM-M296 - ITS.

GCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGTATTCAGTGAATCATCGAACCTTTGAACGCACCTTGCGCCCCTTGGAAATTCCGTCGGGCATGCCTGTCTGAGTGTCATGTGGACTTCGACCCTGAGGGTTATTCCCCCGGGGCCGGACTTGGGCGCCGCCTCACCCGGCCCGCCTCAAATGCATCAGCGGGACGCGACGTCATAAGCACCGTCCGTGTCCCGCCCACAGAACACCCATCTTGTAACTCTGACCTCAGATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

 

Price: $350

Add to cart

 

Overnight shipping is recommended for this culture

Our technical staff is available to answer your questions on culture media, culture maintenance, fruiting strategies or other questions that may arise as you work with cultures. For more details please see Consulting Services.

 

For all of you formulators - Aloha Medicinals also offers bulk powder ingredients for use in your formulations, which are 100% USDA and EU Certified Organic. Call our customer service representative at (775) 886-6300 for more information and to place your order today!